首页 | 学科概况 | 教学信息 | 科研信息 | 网络教学 | 成果展示 | 服务信息 
 

 
当前位置: 首页>>科研信息>>学术活动>>正文
 
学术活动:Hepatic Cells Derived From Induced Pluripotent Stem Cells of Pigtail Macaques Support Hepatitis C Virus Infection
2014-03-19 08:57 乔卿华  发布范围:公开

 

Abstract

The narrow species tropism of hepatitis C virus (HCV) limits animal studies. We found that pigtail macaque (Macaca nemestrina) hepatic cells derived from induced pluripotent stem cells support the entire HCV life cycle, although infection efficiency was limited by defects in the HCV cell entry process. This block was overcome by either increasing occludin expression, complementing the cells with human CD81, or infecting them with a strain of HCV with less restricted requirements for CD81. Using this system, we can modify viral and host cell genetics to make pigtail macaques a suitable, clinically relevant model for the study of HCV infection.

Keywords

  • Animal Model; 
  • Monkey; 
  • Hepatitis C Virus; 
  • Replication

Abbreviations used in this paper

  • 2′CMA, 2′C-methyl-adenosine; 
  • GLuc, Gaussia luciferase; 
  • HCV, hepatitis C virus; 
  • HCVcc, cell culture–derived hepatitis C virus; 
  • HCVpp, hepatitis C virus pseudoparticles; 
  • Mn, Macaca nemestrina; 
  • MnHep,Macaca nemestrina–derived hepatocyte-like cells; 
  • MniPSC, Macaca nemestrina induced pluripotent stem cells; 
  • OCLN, occludin; 
  • VSVGpp, vesicular stomatitis virus glycoprotein

Hepatitis C virus (HCV) is responsible for more than half of all liver cancers in the Western Hemisphere and the majority of liver transplants worldwide.1 No HCV vaccine is available, and treatment is often ineffective and complicated by adverse effects and viral resistance.2 HCV is only known to naturally infect humans and chimpanzees (reviewed in Bukh3). Because of the moratorium on chimpanzee research and associated ethical and financial issues, an alternative animal model is needed to study HCV in vivo pathogenesis and replication and to develop antiviral agents and vaccines. Here, we sought to determine whether pigtail macaque (Macaca nemestrina [Mn])-derived hepatocyte-like (MnHep) cells support HCV replication, with the ultimate goal of developing an immunocompetent nonhuman primate HCV animal model.

Several groups have recently shown that human induced pluripotent and embryonic stem cells can be differentiated into hepatic cells that support HCV infection.4, 5, 6 and 7 We used a similar approach to differentiate MnHep cells from Mn induced pluripotent stem cells (MniPSCs)8 (Supplementary Figure 1). To test their ability to support HCV infection, MnHep and Huh-7.5 cells were challenged with infectious HCV derived in cell culture (HCVcc; HCV cell cultured systems reviewed in Vieyres et al9). MnHep cells supported HCVcc infection and replication, as gauged by increased intracellular HCV RNA over time and HCV E2 glycoprotein cell staining, both of which were inhibited by the HCV polymerase inhibitor 2′C-methyl-adenosine (2′CMA)10 (Figure 1A and 1C). However, this process was inefficient, as HCV RNA levels in MnHep cells were 13.1-fold lower than levels observed in positive control human Huh-7.5 cells. It should be noted that even approaching Huh-7.5 HCV infection levels is an achievement, because most primary cell culture systems allow infections that are dramatically less efficient. We believe that pluripotent stem cell–derived hepatic cells are simply better hosts for HCV replication than cultured primary cells. Indeed, we recently showed that human embryonic stem cell–derived hepatic cells support HCV infection with similar efficiency as compared with Huh-7.5 cells. 11 HCV-infected Huh-7.5 and MnHep cells secreted proportional amounts of HCV RNA ( Figure 1B) that were shown to be associated with infectious virus on Huh-7.5 cells (Figure 1D), and the amount of HCV RNA secreted by Huh-7.5 and MnHep cells was proportional to the amount of infectious virus in the subsequent infection experiments. Thus, although MnHep cells support HCV infection, at least one step of the viral life cycle may be inefficient in these cells.

Full-size image (81 K)
Figure 1. 

MnHep cells support HCV infection. To gauge their capacity to support HCV infection, Huh-7.5 and MnHep cells were challenged with wild-type genotype 2a Jc1 HCVcc. At the indicated hours postinfection (h.p.i.), (A) intracellular and (B) extracellular RNA was quantified by quantitative reverse-transcription polymerase chain reaction. 2′CMA, an HCV polymerase inhibitor, was included in parallel infections to show replication-independent RNA levels. Values represent the absolute number of HCV RNA copies determined relative to a standard curve in relationship to the quantity of total RNA for intracellular samples or volume of supernatant for extracellular samples. (C) At 96 h.p.i., mock or HCV-infected cells, with or without 2′CMA, were immunostained for the HCV E2 glycoprotein (red) and Hoechst counterstained (blue). (D) Infectious HCV in supernatants collected at 48 h.p.i. was quantified by limiting dilution assay on Huh-7.5 cells and expressed as 50% tissue culture infectious dose per milliliter (TCID50/mL). Means and SDs of 3 independent experiments, each performed in triplicate. ***P < .001 (Mann–Whitney test)

HCV cell entry is one stage of the viral life cycle that influences both the tissue and species tropism of HCV infection.12 To specifically test their capacity to support HCV cell entry, MnHep and Huh-7.5 cells were challenged with lentiviral particles bearing the HCV envelope glycoproteins (HCVpp) that encoded Gaussia luciferase (GLuc) (reviewed in Vieyres et al9). After normalization to parallel infections with lentiviral particles bearing the vesicular stomatitis virus glycoprotein (VSVGpp) to control for subtle differences in cell numbers, MnHep cells (expressing green fluorescent protein alone as a negative control) were 7.9-fold less infectable than Huh-7.5 cells (Figure 2A). Importantly, the level of entry into MnHep cells was dependent on authentic HCV glycoprotein function, because infection was inhibited by an HCV E2 glycoprotein neutralizing antibody.13

Full-size image (92 K)
Figure 2. 

Cellular and viral determinants of MnHep cell HCV entry capacity. MnHep cells transduced to express green fluorescent protein (GFP) alone as a negative control or the indicated HCV cell entry factors were challenged with GLuc expressing (A) genotype 1a H77 HCVpp or (B) genotype 2a Jc1 HCVcc. Infections were performed in parallel with an HCV neutralizing antibody (Anti-E2) or 2'CMA, respectively. GLuc values were measured at 48 h.p.i. for HCVpp or the indicated times for HCVcc, normalized to parallel VSVGpp infections, and set relative to infection of highly permissive Huh-7.5 cells. Three independent experiments, each performed with 6 replicates, are represented, and statistics are relative to GFP alone. Naïve Huh-7.5 and MnHep cells were challenged with mouse CD81 adapted HCVcc, and (C) intracellular and (D) extracellular HCV RNA levels were assayed as described in the preceding text. Three independent experiments were each performed in triplicate. ***P < .001 (Mann–Whitney test).

Of the many cellular factors required for HCV cell entry, 4 influence HCV tropism (reviewed in Ploss et al14). Cell type expression patterns of scavenger receptor class B type I and claudin-1 affect the tissue tropism of this process, while sequence differences in CD81 and occludin (OCLN) influence species tropism. All 4 of these factors were expressed in MnHep cells (Supplementary Figure 2AC). Overexpression of the human versions of scavenger receptor class B type I and claudin-1 in these cells (monitored by immunoblot;Supplementary Figure 2E) did not enhance infection with HCVpp ( Figure 2A) or HCVcc ( Figure 2B). Thus, the Mn and human versions of these proteins were equally functional and present at saturating levels. Overexpression of either human or Mn OCLN enhanced infection with GLuc reporter expressing HCVpp and HCVcc ( Figure 2A and B), which indicated that MnHep OCLN levels were limiting for HCV entry. It was not surprising that the OCLN proteins from both species functioned equally well, because sequences previously defined to be critical for this activity are similar ( Supplementary Figure 3A) and both versions functioned equally in OCLN-deficient human 786-O cells ( Supplementary Figure 3B). Overexpression of human, but not Mn, CD81 enhanced HCVpp and HCVcc infection more than OCLN overexpression ( Figure 2A and B). The Mn version of CD81 is identical to the African green monkey orthologue ( Supplementary Figure 4A), which was previously shown to exhibit 25% of the function of the human protein 15, which we confirmed in CD81-deficient human HepG2 cells ( Supplementary Figure 4B). Cotransduction of human, but not Mn CD81, with either version of OCLN further enhanced HCVpp and HCVcc infection ( Figure 2A and B). In summary, inefficient MnHep HCV cell entry caused by low OCLN expression levels and suboptimal activity of Mn CD81 limit could be overcome by genetic manipulation of these cells.

Bitzegeio et al recently identified a mutant HCVcc that efficiently uses both human and mouse CD81 proteins.16 This virus infected MnHep cells only 3.9-fold less efficiently than Huh-7.5 cells (Figure 2C), and these cells released proportional levels of HCV RNA ( Figure 2D). Thus, based on the above result that wild-type HCVcc infected MnHep cells 13.1-fold less efficiently than Huh-7.5 cells, the mouse CD81 adapted virus infects MnHep cells 3.4-fold better than wild-type HCVcc (P < .001). These findings indicate that the low levels of HCV entry observed in MnHep cells can be overcome by genetic viral adaptation.

In summary, we show that hepatic cells derived from MniPSCs support HCV infection, which was further enhanced by modifications to both viral and cellular proteins. This significant finding challenges the historical assumption that only human and chimpanzee cells are susceptible to HCV. Indeed, a prior study failed to show HCV infection of rhesus macaques.17 It is possible that the entry block described in the preceding text was enough to prevent infection in this study. It is also feasible that the particularly strong replication kinetics of the JFH-1 strain used in our study were required to observably infect cells from macaques. Nevertheless, our study suggests that the pigtail macaque may indeed be a suitable model for studying HCV infection. Given the current restriction on chimpanzee research, the development of an alternative clinically relevant nonhuman model is critical for in vivo testing of novel HCV therapies. Our system provides a platform to study HCV-host interactions that influence the efficiency of HCV infection of these cells, which could lead to more tractable nonhuman animal models.

Acknowledgments

The authors thank Charles Rice for pseudoparticle and HCVcc-related plasmids, Timothy Tellinghuisen for 2′CMA, and Mansun Law for the E2 monoclonal antibody.

Supplementary Methods

Mn iPSC Culture

The derivation and validation of MniPSC line 3 has been previously described.1 Before differentiation studies, the normal karyotype and the phenotype were confirmed by flow cytometry. Cells were maintained on irradiated mouse embryonic fibroblast (MEF) feeder layers in mTESR media (Life Technologies, Grand Island, NY) supplemented with 20 ng/mL of basic fibroblast growth factor (R&D Systems, Minneapolis, MN).

Hepatic Differentiation

MniPSCs were induced toward definitive endoderm and then specified toward the hepatic lineage using a modified version of a protocol for human embryonic stem cells that has been described2 (Supplementary Figure 1A). Briefly, the day before differentiation, MniPSCs were harvested using Accutase (Life Technologies, Grand Island, NY) and passaged on Matrigel (BD Biosciences, San Jose, CA) to exclude the murine embryonic fibroblasts. On day 0 of differentiation, MniPSCs were harvested using Accutase and cultured in low cluster plates (Corning Costar, Tewsbury, MA) to allow formation of embryoid bodies in the presence of BMP4 (3 ng/mL) and Y-27632 ROCK inhibitor (RI; 5 μmol/L; EMD Millipore Calbiochem, Billerica, MA) in serum-free differentiation media as previously described. 2 On day 1 of differentiation, endoderm program was induced with Activin-A (100 ng/mL) in serum-free differentiation media supplemented with basic fibroblast growth factor (2.5 ng/mL) and BMP4 (0.5 ng/mL). On day 4, the medium was changed to serum-free differentiation media supplemented with Activin-A (100 ng/mL), basic fibroblast growth factor (2.5 ng/mL), and vascular endothelial growth factor (10 ng/mL). On day 5, embryoid bodies were dissociated with trypsin/EDTA 0.25% (Corning CellGro, Manassas, VA) and subsequently plated on gelatin-coated dishes (30,000 cells per well of a 48-well plate) in defined hepatic media as previously described. 2 All cytokines were purchased from R&D Systems.

RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction

Total RNA was prepared with the RNeasyMicro Kit (Qiagen, Gathersburg, MD). RNA was reverse transcribed into complementary DNA (cDNA) using the Superscript III First-Strand Synthesis System Kit (Life Technologies). All experiments were performed in triplicate using the Roche SYBR Green Master Mix and the LightCycler 480 I Real Time PCR System (Roche Applied Science, Indianapolis, MD). Relative quantification was calculated using the comparative threshold cycle (CT) method and was normalized against the ΔCT of the housekeeping gene β-actin. Melting curves for each gene were used to confirm homogeneity of the DNA product. The following primer sequences were used: SRBI: forward 5′TCCTCGAGTACCGCACCTTCCA, reverse 5′AGTCAACCTTGCTCAGCCCGTT; OCLN: forward 5′AGACCCAAGAGCAGCAAAGGGC, reverse 5′ACAATGGCAATGGCCTCCTGGG; CD81: forward 5′ATGACCCGCAGACCACCAACCT, reverse 5′TCCTTGGCGATCTGGTCCTTGT; AFP forward 5′CTACCTGCCTTTCTGGAAGAACTTTG, reverse 5′GATCGATGCTGGAGTGGGCTTT; FOXA2: forward 5′AAGTGGGGGTCGAGACTTTG, reverse 5′CTGCAACAACAGCAATGGAG; CK19: forward 5′CCGCGACTACAGCCACTACT, reverse 5′GAGCCTGTTCCGTCTCAAAC; ALB: forward 5′GTGAAACACAAGCCCAAGGCAACA, reverse 5′TCCTCGGCAAAGCAGGTCTC; CK18: forward 5′ATCTTGGTGATGCCTTGGAC, reverse 5′CCTCAGAACTTTGGTGTCATTG; CYP3a4: forward 5′GTGACCAAATCAGTGTGAGGAGGTA, reverse 5′AGGAGGAGTTAATGGTGCTAACTGG; HNF4α: forward 5′CATCAGAAGGCACCAACCTCAACG, reverse 5′ATACTGGCGGTCGTTGATGTAGTCC; AAT: forward 5′AGGGCCTGAAGCTAGTGGATAAGT, reverse 5′TCTGTTTCTTGGCCTCTTCGGTGT; ACTIN: forward 5′TTTTTGGCTTGACTCAGGATTT, reverse 5′GCAAGGGACTTCCTGTAACAAC; CDH1: forward 5′GGCCTGAAGTGACTCGTAACG, reverse 5′TCAGACTAGCAGCTTCGGAACC; miR122: forward 5′AGCAGAGCTGTGGAGTGTGAC, reverse 5′AGCTATTTAGTGTGATAA; CLDN1: forward 5′ GGGTTGCTTGCAATGTGCTGCTC, reverse 5′ TCTCTGCCTTCTGCACCTGCC.

For quantifying HCV RNA, quantitative real-time polymerase chain reaction (qRT-PCR) was performed on 20 ng of total RNA or 2 μL of extracted RNA from supernatant, prepared with the QIAamp Viral RNA Kit (Qiagen), the HCV 5′UTR TaqMan Assay Kit (Pa03453408_s1; Life Technologies, Grand Island, NY), and the LightCycler 480 Master Hydrolysis Probes Kit (Roche) using the LightCycler 480 II Real Time PCR System (Roche).

Flow Cytometry

Day 5 embryoid bodies or MnHep cells at days 10 and 12 were dissociated with trypsin 0.25%. Cells were stained with CXCR4-PE (R&D Systems, Minneapolis, MN), cKIT-PECy7 (BD Biosciences, San Jose, CA), CD81 (BD Biosciences), OCLN (Life Technologies, Grand Island, NY), CLA-1/SR-BI (BD Biosciences), or immunoglobulin (Ig) G control (BD Biosciences) in phosphate-buffered saline (PBS) with bovine serum albumin 0.1% at 4°C for 20 minutes, with 0.05% saponin (Sigma, St Louis, MO) for OCLN and CLA-1/SR-BI. Cells were then incubated with donkey anti-rabbit IgG/Alexa Fluor 488 or donkey anti-mouse IgG/Alexa Fluor 488 (Life Technologies). Cells were analyzed using a LSRII flow cytometer (Becton Dickinson, Franklin Lakes, NJ).

Immunocytochemistry

Cells were fixed in 4% paraformaldehyde/PBS for 15 minutes at room temperature and rinsed with 1× PBS. For intracellular staining, cells were permeabilized with 0.1% Triton X-100 in PBS for 10 minutes at room temperature. Cells were incubated overnight with control isotype (mouse IgG or rabbit IgG; Jackson ImmunoResearch Laboratories, West Grove, PA) or with monoclonal antibodies anti-AFP (Dako, Carpinteria, CA), anti-FOXA2 (Novus Biologicals, Littleton, CO), anti-GATA4 (Santa Cruz Biotechnology, Santa Cruz, CA), anti–HNF-4α (Santa Cruz Biotechnology, Santa Cruz, CA) anti-CK18 (Sigma, St Louis, MO), anti-TTR (Abbiotec, San Diego, CA), anti-CD81 (BD Biosciences), and OCLN (Life Technologies). Cells were than incubated with secondary antibodies donkey anti-rabbit IgG-Cy5, donkey anti-mouse IgG-Cy3, or donkey anti-goat IgG-Cy3 (Jackson ImmunoResearch Laboratories, West Grove, PA) for 1 hour at room temperature and counterstained with 4,6′-diamidino-2-phenylindole (DAPI). Stained cells were visualized using a confocal or regular fluorescent microscope (Leica, Buffalo Grove, IL) and images captured using the Leica software. For HCV E2 staining, cells were permeabilized with 0.05% saponin for 10 minutes at room temperature, incubated for 1 hour with anti-E2 monoclonal antibody (clone AR3A,)3 provided by Mansun Law (Scripps Research Institute, La Jolla, CA), then incubated with goat anti-mouse IgG/Alexa Fluor 568 (Life Technologies), and finally counterstained with Hoechst (Life Technologies).

Hepatic Functional Assays

For LDL-acetylated uptake, cells were incubated 6 hours at 37°C with Alexa Fluor 488/acLDL (Life Technologies). Stained cells were visualized using a fluorescent microscope (Leica).

For periodic acid–Schiff staining, cells were fixed in 4% paraformaldehyde/PBS for 15 minutes at room temperature before performing the periodic acid–Schiff assay as per the manufacturer's instructions (Sigma).

Virus Generation and Infection

Production of HCV and VSVG pseudoparticles was performed as previously described4 and 5 by cotransfection of 3 plasmids encoding (1) a provirus containing the desired reporter (V1-GLuc), (2) HIV Gag-Pol, and (3) the necessary envelope glycoprotein(s) (HCV H77 1a E1E2 or VSVG). Briefly, 293-T cells were seeded at 7 × 106 cells/well into a poly-l-lysine–coated 10-mm-diameter plate (Sigma). Transfection was performed the next day with TransIT-LT1 Transfection Reagent (Mirus, Madison, WI). Supernatants were collected 2 and 3 days posttransfection and filtered (0.45-μm pore size). HCV pseudoparticles were concentrated 200 times by centrifugation through a 20% sucrose cushion for 2 hours at 4°C and 34,000 rpm. All infection assays using pseudoparticles were performed in the presence of 4 μg/mL Polybrene (Sigma) and 0.01 mol/L HEPES (Life Technologies).

To produce HCVcc, 2 HCV genome configurations were used. Both encoded the structural proteins and a portion of NS2 from the HC-J6 isolate cloned in the context of the rest of the genome from the JFH-1 isolate. This genome, termed Jc1, was used because it produced a high level of infectious virus in cell culture.6 One configuration represented the normal HCV genomic organization, and the other was a reporter virus that expressed the GLuc7 off the HCV internal ribosome entry site (IRES), with the IRES from the encephalomyocarditis virus directing translation of the HCV polypeptide. Plasmids encoding both HCVcc configurations were provided by Charles Rice (Rockefeller University, New York, NY). HCVcc stocks were produced as previously described.5 Briefly, supernatants from Huh-7.5 cells transfected by electroporation with in vitro transcribed HCV genomic RNA were collected at 2, 3, and 4 days posttransfection and filtered (0.45-μm pore size). HCVcc stocks were concentrated 200 times by centrifugation through a 20% sucrose cushion for 2 hours at 4°C and 34,000 rpm. Depending on the efficiency of virus concentration, nonreporter HCV was used at an approximate multiplicity of infection of 1 to 10 and GLuc-expressing HCVcc was used at a multiplicity of infection of 0.01 and 0.1, as determined by titration on Huh-7.5 cells.

Infections were performed in triplicate on cells seeded on 48-well plates with 10 μL of HCVpp or HCVcc or 0.01 μL of VSVGpp added in 0.2 mL fresh media. For pseudoparticle infections, media was supplemented with 4 μg/mL Polybrene (Sigma) and 50 mmol/L HEPES (Life Technologies). MnHep cells were infected at day 12 or day 13 of differentiation. Twenty-four hours postinfection, cells were washed 3 times with fresh media to remove GLuc protein present in the inoculum. Supernatants were harvested 2 days postinfection in 25 μL Renilla luciferase assay lysis buffer (Promega, Madison, WI), and the expression of the luciferase reporter was measured as previously described.8

Virus titration was performed by limiting dilution assay as previously described.9 Briefly, rows of Huh-7.5 cells seeded in poly-l-lysine–coated 96-well plates at 3 × 104 cells/well were infected with serial dilutions of virus. Three days postinfection, infected cells were fixed and immunostained for NS5A as described in Lindenbach et al9using the clone 9E10 anti-NS5A antibody, provided by Charles Rice (Rockefeller University), and detection was performed with the ImmPRESS peroxidase anti-mouse conjugated antibody (Vector Laboratories, Burlingame, CA). Wells that expressed at least one NS5A-expressing cell were counted as positive, and the 50% tissue culture infectious dose per milliliter was calculated according to the method of Reed et al.10

To neutralize HCVpp infection, the anti-E2 monoclonal antibody (clone AR3A),3 provided by Mansun Law (Scripps Research Institute, La Jolla, CA), was used at a concentration of 10 μg/mL. The HCV polymerase inhibitor 2′CMA11 was provided by Timothy Tellinghuisen (Scripps Research Institute, Jupiter, FL) and used at 6 μmol/L to inhibit HCVcc intracellular RNA replication.

Rescue and Activity Evaluation of HCV Cell Entry Factors

Because the coding sequences for Mn OCLN and CD81 have not been previously reported, we rescued their open reading frame (ORF) sequences by reverse-transcription PCR with oligos designed of highly conserved regions of each. To ensure that the correct sequences were identified, multiple independent cDNA syntheses and PCRs were used to assemble consensus sequences. Reverse transcription was performed using the SuperScript III First-Strand Synthesis System (Life Technologies) according to the manufacturer's instructions, with an oligo dT primer and total RNA prepared from day 13 postdifferentiation MnHep cells as the template. The Mn OCLN sequence was PCR amplified from this cDNA with forward (5′ GAAGATCAGCTGACCATTGACA) and reverse (5′ AAAATTCTTAATTGGAGTGTTCAGCCCAGT), which anneal just before and after the protein coding sequence. This sequence has been deposited in GenBank as accession number KF188431. For cell culture expression, oligos 5′-A GAC ACC GAC TCT AG A GGA TCT AGA ATG TCA TCC AGG CCT CTT GAA AGT and 5′-TTGCTCACCATGTTTAAACCCGGTGGGGATCTTGTTTTCTGTCTATCATAGTCTCC were used to precisely amplify the coding sequence. A “sequence- and ligation-independent cloning” method12 was used to clone this product into the TRIP plasmid,13 and 14 a self-inactivating lentiviral provirus that expresses no HIV proteins but instead uses an internal cytomegalovirus promoter to express cloned genes. For vector, TRIP-hOCLN-PmeIGFP, which is a TRIP vector encoding the human OCLN ORF fused to the amino-terminus of green fluorescent protein (GFP) and has been previously described,8 was digested with the restriction enzymes XbaI and PmeI (New England Biolabs, Ipswich, MA). This plasmid was designated TRIP-MnOCLN-GFP.

The Mn CD81 ORF was amplified from the previously described cDNA with forward (5′ GCT AGC ATG GGA GTG GAG GGC TGC ACC) and reverse oligos (5′ ACT AGT GTA CAC GGA GCT GTT CCG GAT), and the rescued sequence was deposited in GenBank as accession number KF188430. To clone the coding sequence into the TRIP plasmid, this product was digested with NheI and SpeI and ligated into like digest TRIP-GFP-hCD81-linker, 15 which encodes the human CD81 protein fused to the carboxyl-terminus of GFP, to generate TRIP-GFP-MnCD81-linker.

VSVGpp lentiviral pseudoparticles encapsidating the previously described TRIP vectors, TRIP-GFP,13 and 14 TRIP-GFP-hSRBI-linker,15 which encodes GFP fused to the human SR-BI protein, and TRIP-GFP-hCLDN1-linker,15 which encodes GFP fused to the human CLDN1 protein, were generated as described previously. To generate MnHep cells expressing these proteins, the pseudoparticles were concentrated by ultracentrifugation for 2 hours at 4°C and 34,000 rpm. All transductions were performed in the presence of 4 μg/mL Polybrene (Sigma) and 0.01 mol/L HEPES (Life Technologies). Transduction efficiency was monitored by GFP expression, and immunoblotting confirmed transgene expression.

To test OCLN- and CD81-related HCV cell entry functions, human 786-O or HepG2 cells, which are deficient in endogenous OCLN and CD81, respectively, were transduced with unconcentrated VSVGpp supernatants. Transduction efficiency was monitored by GFP expression, and immunoblotting confirmed transgene expression.

Immunoblot Analysis

For immunoblot analysis of GFP expression, transduced MnHep cells were lysed in a volume of 1× sodium dodecyl sulfate/polyacrylamide gel electrophoresis sample buffer plus dithiothreitol that was proportional to the approximate cell confluency. Cell lysates were passed through a 22-gauge needle several times and heated for 5 minutes at 95°C. Equivalent volumes of lysate were immunoblotted with rabbit anti-GFP (ab290; Abcam, Cambridge, MA) and mouse anti–β-actin antibodies (AC-15; Sigma) to ensure analysis of comparable protein concentrations. For both antibodies, horseradish peroxidase–conjugated goat anti-mouse and goat anti-rabbit secondary antibody (GE Healthcare Life Sciences, Pittsburgh, PA) was used, and detection was performed with Immobilon Chemiluminescent HRP (Millipore, Billerica, MA).

Statistical Analysis

Data were analyzed for statistical significance with Prism software (GraphPad Software, La Jolla, CA) using the Mann–Whitney test. P ≤ .05 was considered significant.

Full-size image (167 K)
Supplementary Figure 1. 

Generation of MnIPSC derived hepatic cells. (A) Illustration of the hepatic differentiation protocol used to generate MnHep cells from MniPSC cells, as described in Supplementary Methods. (B) By day 5 of endoderm differentiation, the majority of cells (86.5%) had developed into definitive endoderm-enriched populations, as gauged by the flow cytometry analysis of coexpression of 2 endodermal markers: CXCR4 and cKIT. On day 5, endoderm-enriched population cells were plated onto gelatin and specified toward the hepatic lineage. On the indicated days of differentiation, cells were fixed and immunostained for (C) the endoderm markers FOXA2 and GATA4 and (D) the hepatic markers HNF4α, α-fetoprotein (AFP), and transthyretin (TTR) and the epithelial marker cytokeratin 18 (CK18). Nuclei of cells were also counterstained with DAPI. Note that virtually all cells express GATA4 and FOXA2 and that most cells are positive for AFP, CK18, and TTR, indicative of an efficient endoderm induction and hepatic specification (200-fold magnification). (E) Relative transcript levels, as determined by qRT-PCR at the indicated days of differentiation, of early hepatic endoderm markersFOXA2, HNF4α, and CK19 decreased over time, while markers for specification and maturation AFP, CK18,CYP3a4, albumin (ALB), α1-antitrypsin (AAT), and E-cadherin increased over time, indicative of maturation of hepatic cells. Levels of the master regulator of hepatic cell fate, HNF4α, remained relatively constant with time. Shown are means and SDs from 3 independent cultures. (F) MnHep cells at differentiation day 12, but not day 0, efficiently internalize acetylated LDL (Alexa Fluor 488–acLDL) (green staining). (G) Periodic acid–Schiff staining of day 9, 12, and 17 hepatic cultures showed increasing glycogen storage (red staining) with time in hepatic cells. (H) The bright field pictures show confluent monolayers with hepatic cell morphology developing at day 12.

Full-size image (121 K)
Supplementary Figure 2. 

MnHep cell HCV entry factor expression. At the indicated days of hepatic differentiation, the expression levels of the cellular factors required for HCV cell entry in naïve MnHep cells were gauged by (A) qRT-PCR (means and SDs of n = 3 analysis, normalized to ACTIN); (B) flow cytometry analysis for CD81, occludin, SR-B1, and IgG control (because a suitable antibody to stain MnCLDN1 was not identified, this protein was not analyzed by fluorescence-activated cell sorting), and (C) immunostaining for OCLN. Note that although OCLN transcript levels do not vary greatly, this protein is not detected until 12 days into the differentiation process. (D) The levels of miR-122 were quantified by qRT-PCR from total RNA samples collected at the indicated day of differentiation. (E) Immunoblot with antibodies that bind either GFP, to track transgene expression, or Actin, as a loading control of lysates from naïve MnHep cells or those transduced with lentiviruses to express a fusion protein of GFP and the indicated HCV cell entry factor. Approximate molecular weight (kilodalton) marker positions are indicated to the left, and the predicted size of each expressed protein is marked on the right of each blot.

Full-size image (66 K)
Supplementary Figure 3. 

Comparison of OCLN orthologue HCV cell entry functions. (A) The MnOCLN coding sequence was amplified from MnHep cDNA as described in Materials and Methods. The MnOCLN protein sequence had 97.3% identity and 98.7% similarity to human OCLN and 99.8% identity and 99.8% similarity to the Rhesus macaque OCLN protein (only encoded a single alanine-to-valine change in the second transmembrane domain at amino acid position 157). Shown is an alignment of the OCLN second extracellular loop sequences of the indicated species, with amino acid numbering corresponding to the human OCLN sequence and identical and similar amino acids shaded dark and light, respectively. We previously showed that this region contains the determinants for differences in OCLN HCV cell entry factor activity between these species. 8 A line above the alignment marks the cluster of residues shown to be most important for species-specific functions. (B) To test OCLN entry factor activities, 786-O cells, which are unable to support HCV cell entry due to insufficient levels of endogenous OCLN, 5 were transduced to express either GFP alone or GFP fused to OCLN from the indicated species. These cells were challenged with HCVpp as described in Materials and Methods. Luciferase reporter levels, assayed 2 days postinfection, are shown normalized to parallel infections with VSVGpp, which infect nearly all mammalian cells and thus help control for cell number variations, and set relative to infections of cells expressing human OCLN. Mean and SE of 2 independent experiments, each performed in quadruplicate, are shown. (C) Immunoblots for either GFP or actin of lysates from 786-O cell populations transduced to express the indicated transgenes. Approximate molecular weight (kilodaltons) marker positions are indicated to the left of each blot. **P < .01 (Mann–Whitney test).

Full-size image (43 K)
Supplementary Figure 4. 

Comparison of CD81 orthologue HCV cell entry functions. (A) The MnCD81 coding sequence was amplified from MnHep cDNA as described in Materials and Methods. Although this sequence shared 98.3% identity and 99.2% similarity with the human CD81 sequence, it has 100% identity with the Rhesus macaque and African green monkey CD81 proteins, the latter of which was previously shown to mediate HCV cell entry less efficiently than the human version due to diminished HCV E2 glycoprotein binding. 16 Shown in this figure are the only 4 amino acid differences between these sequences, all occurring in the CD81 large extracellular loop. The amino acid positions are labeled above the sequence, and identical and similar amino acids are shaded dark and light, respectively. (B) HCVpp infectivity (normalized to parallel VSVGpp infections and relative to infections of cells expressing human OCLN) of HepG2 cells, which normally do not support HCV cell entry due to a lack of endogenous CD81, expressing either GFP alone or GFP fused to the CD81 protein from the indicated species. Mean and SE of 2 independent experiments, each performed in quadruplicate, are shown. (C) Immunoblots for either the GFP or actin of lysates from HepG2 cell populations transduced to express the indicated transgenes. Approximate molecular weight (kilodalton) marker positions are indicated to the left of each blot. **P < .01 (Mann–Whitney test).

上一条:学术活动:Hepatitis C virus 3′UTR regulates viral translation through direct interactions with the host translation machinery
下一条:High-throughput, luciferase-based reverse genetics systems
关闭窗口
 
 
设为首页  |  加入收藏  |  网站地图


第四军医大学基础部 医学微生物学教研室  地址:西安市长乐西路169号 Email:hfrs0924@fmmu.edu.cn